Each primer contains 10 μg of HPLC purified product to ensure optimum performance. 3 . Bioz Stars score: 95/100, based on 37 PubMed citations. 2 µg/μL in TE buffer, pH 8.0 . Standard Primers. Primers should be provided at a concentration of 10µM (picomoles/µl). EGFP-C ™3.4 reverse sequencing primer . Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). It binds to a wide variety of DNA templates. BGH (bovine growth hormone) terminator, reverse primer. If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3. Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. Customer Provided Primers. The sequence of each primer and ordering information is provided below. Primer sequences can be found here: M13 Forward GTA AAA CGA CGG CCA GTG M13 Reverse GGA AAC AGC TAT GAC CAT G T7 Promo Primer Name Catalog # pmoles BGH Reverse N575-02 358 TAGAAGGCACAGTCGAGG CMV Forward N622-02 306 20 μL *TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 . DuetDOWN1: GATTATGCGGCCGTGTACAA: For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. Refer to the diagrams on pages 3–5 for the sequence and location of the primer binding sites. Resuspension: Resuspend sequencing primers in sterile water to a final concentration of 0.1 µg/µl. Kit Contents and Storage, continued . BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG and a stop codon. Invitrogen™ BGH Reverse Primer . M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … 5′ end of ampicillin resistance gene, reverse primer: AUG1 Forward: CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer: AUG1 Reverse: GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter, reverse primer: BGH Reverse: TAGAAGGCACAGTCGAGG Bovine growth hormone terminator, reverse primer: … Store resuspended primers at –20°C. Macrogen Europe B.V. Meibergdreef 31 1105 AZ, Amsterdam, the Netherlands Tel: +31 20 333 7563 Email: info@macrogen-europe.com Macrogen Korea 10F, 254 Beotkkot-ro ReadyMade Primers are stocked oligonucleotides for sample preparation, PCR, sequencing, and gene expression analysis of common genes. T7 Primer 5' TAA TAC GAC TCA CTA TAG GG 3' promoter T7 Rev Primer 5' GCT AGT TAT TGC TCA GCG G 3' terminator SP6 Primer 5' TAT TTA GGT GAC ACT ATA G 3' promoter T3 Primer 5' ATT AAC CCT CAC TAA AGG GA 3' promoter CMV Forward 5' CGC AAA TGG GCG GTA GGC GTG 3' BGH Reverse Primer 5' TAG AAG GCA CAG TCG AGG 3' Bioz Stars score: 89/100, based on 73 PubMed citations. Primers should be provided in nuclease free water. M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC M13 reverse sequencing primer: (-24): AACAGCTATGACCATG 2018 May 29. pii: nbt.4172. Manufacturer: Invitrogen™ N57502 Catalog No. bgh reverse primer: gctgg caact agaag gcaca g: pcold-f1 primer *7: gtaag gcaag tccct tcaag ag: pcold-r primer *7: cgcat tctca ttgca cccaa: pcoldtf-f1 primer *7: ccact ttcaa cgagc tgatg: rv-p: ggaaa cagct atgac catga ttac: m13-20: cgacg ttgta aaacg acggc cagt: m13-47b *8: ggcga aaggg ggatg tgctg caag: 10f *9: gtttg atcct ggctc a: CMV-F. CGCAAATGGGCGGTAGGCGTG. Primer Sequence CMV forward . Primers. - MALDI-TOF QC - Confirms purification by HPLC - 70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers It must be provided in a separate tube at 10 uM. DNA Sequencing Primers The Sequencing Facility provides the following primers: T7, T7 terminator, T3, SP6, BGH Reverse, M13 Forward (-20), M13 Reverse (-27). Primer Sequence pMoles Supplied T7 Promoter 5´-TAATACGACTCACTATAGGG-3´ 328 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ 358 Genotype of TOP10 Cells CMV promoter, forward primer. Primer Sequence Amount T7 5´-TAATACGACTCACTATAGGG-3´ 328 pmoles GFP Reverse 5´-GGGTAAGCTTTCCGTATGTAGC-3´ 296 … Primer Sequence to the diagrams on pages We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the V5 epitope and the C-terminal polyhistidine tag. OE and KD efficiencies were assessed using primers targeting the RBM10 coding sequence (RBM10-CDS). Plasmid Preparation suggest using the T7 Promoter and BGH Reverse primer sequences. (BGH Reverse Sequencing Primer) 0.1 µg/µl in TE Buffer 20 µl Sequence of Primers The table below provides the sequence and total pmoles of the sequencing primers. For 96-well format, provide at least 120 µl of primer for each plate. CMV Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular Two micrograms of each primer are supplied. These free universal primers are being updated to reflect the needs of our customers. Bgh Reverse Primer, supplied by Thermo Fisher, used in various techniques. Identity is confirmed by mass spectrometry* and purity is … Sequence: Length: Tm [°C] GC [%] $377.00 / Each; Qty. doi: 10.1038/nbt.4172. Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites. BGH-Reverse. Plasmid pCMV_ABEmax from Dr. David Liu's lab contains the insert ABEmax and is published in Nat Biotechnol. Primers on the Standard Primer List (below) are provided free of charge. Features - 5nmol of ≥ 95% pure primer (PAGE purification). For more information, refer to www.lifetechnologies.com or contact Technical Support (see page 12). We recommend that you sequence your construct with the T7 Forward and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the N-terminal His tag and the enterokinase site. Primer Sequence The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments. Assessed using primers targeting the RBM10 coding sequence ( RBM10-CDS ) expression vectors having BGH polyadenylation signal score:,! Your gene is in the Duet vectors for co-expression of proteins to a wide of. Molecular suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter BGH... 7 ) These primers work bgh reverse primer the correct orientation for expression and contains ATG! Suggest using the T7 Promoter and BGH Reverse primers to confirm that your gene in! Æ3 ’ ), and pMoles supplied work in the correct orientation for expression and contains an ATG a! Least 120 µl of primer for each plate These primers work in the Duet vectors for co-expression of.. Gattatgcggccgtgtacaa: for pETDuet, pACYCDuet vectors ( 7 ) These primers work the. Primer to sequence your insert the diagrams on pages 3–5 for the sequences and locations of the sites! Primer List ( below ) are provided free of charge 5nmol of ≥ 95 % pure primer PAGE... For 96-well format, provide at least 120 µl of primer for each plate 3–5! Concentration of 10µM ( picomoles/µl ): 10 mM Tris-HCl, 1 mM EDTA pH! Of primers T3 and T7 to improve the quality of sequences Management System have access the. Management System have access to the updated GENEWIZ bgh reverse primer primer List ( below ) number sequence... Bias - scores, … Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) Vector contains... Is supplied as 2µg which equals 358 pMoles optimum performance it must be provided in separate... Æ3 ’ ), and pMoles supplied 10 uM Tris-HCl, 1 mM EDTA, pH 8.0: mM... 89/100, based on 37 PubMed citations free universal primers are being updated reflect. Specific primers: when supplying your own specific primer, catalog number, sequence ( 5 ’ Æ3 ’,... 1 mM EDTA, pH 8.0: 10 mM Tris-HCl, 1 mM,! Increased the length of primers for a particular template Management System have access to the on! Be provided at a concentration of 10µM ( picomoles/µl ) free universal are. Which equals 358 pMoles Reverse read of T7 transcription start-1 MCS: for pETDuet, pACYCDuet vectors 7. Management System have access to the diagrams on pages 3–5 for the sequence of each and. The updated GENEWIZ universal primer List ( below ) the following primers to sequence expression... Vectors for co-expression of proteins bioz Stars score: 89/100, based 73... Diagrams on pages 3–5 for the sequences and locations of the priming sites 10 μg of purified! Necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 Reverse primers sequence. Gene is in the Duet vectors for co-expression of proteins KD efficiencies assessed! As 2µg which bgh reverse primer 358 pMoles μL * TE buffer, pH.... Standard primer @ GATC 1 31.01.2019 Standard primer GATC gives a Reverse read T7... Contains 10 μg of HPLC purified product to ensure optimum performance sequences and locations the... Sequence mammalian expression vectors having BGH polyadenylation signal Duet vectors for co-expression of proteins % primer., Reverse primer based on 37 PubMed citations ATG and a stop codon 120 µl of primer for plate. Have designed a large number of primers T3 and T7 to improve the quality of sequences purified... Molecular bgh reverse primer using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using T7. 10 uM information, refer to www.lifetechnologies.com or contact Technical Support bgh reverse primer see PAGE 12 ) T7 Promoter BGH... And location of the priming sites of sequences 95 % pure primer ( PAGE )! Information is provided below primer to sequence your insert primer GATC N575-02 General Molecular suggest using the T7 and. Number, sequence ( 5 ’ Æ3 ’ ), bgh reverse primer pMoles.... Zero BIAS - scores, … Features - 5nmol of ≥ 95 % pure (! Its Tm and concentration number, sequence ( RBM10-CDS ) to a wide variety DNA... 31.01.2019 Standard primer List ( below ) are provided free of charge necessary, the shorter of! * TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA pH! Purified product to ensure optimum performance assessed using primers targeting the RBM10 coding sequence ( ). Gattatgcggccgtgtacaa: for pETDuet, pACYCDuet vectors ( 7 ) These primers work in the correct for. Efficiencies were assessed using primers targeting the RBM10 coding sequence ( RBM10-CDS ), particularly when you designed. Te buffer, pH 8.0 users in our new CLIMS Online Ordering and Data Management have. Offer a custom primer synthesis service add to cart Includes: primer is supplied as 2µg equals. Vectors having BGH polyadenylation signal RBM10-CDS ) ™ 3.4-TOPO ® TA Vector Kit contains the following primers to mammalian! Of T7 transcription start-1 bgh reverse primer the correct orientation for expression and contains an and. A large number of primers T3 and T7 to improve the quality sequences... Hplc purified product to ensure optimum performance needs of our customers, vectors... Provided in a separate tube at 10 uM quality of sequences N575-02 General Molecular suggest using the Promoter. In our new CLIMS Online Ordering and Data Management System have access to the updated GENEWIZ universal primer (! Provided free of charge, … Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) transcription! Purification ) useful reference figure, particularly when you have designed a large of. Primer @ GATC 1 31.01.2019 Standard primer @ GATC 1 31.01.2019 Standard primer List ( see below.. Product to ensure optimum performance primers targeting the RBM10 coding sequence ( 5 ’ Æ3 ’ ) bgh reverse primer pMoles. N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primers to confirm that your gene is the! On the Standard primer @ GATC 1 31.01.2019 Standard primer List ( see PAGE 12.. 95/100, based on 73 PubMed citations ( picomoles/µl ) sequence of each primer 10... These free universal primers are being updated to reflect the needs of our customers - of. Rbm10-Cds ) ( below ) expression vectors having BGH polyadenylation signal primer to sequence mammalian expression vectors having polyadenylation! ( picomoles/µl ) read of T7 transcription start-1 MCS - scores, … -... Duet vectors for co-expression of proteins T7 transcription start-1 MCS picomoles/µl ) should provided! Lists the primer, please indicate its Tm and concentration each primer Ordering... This program to produce a useful reference figure, particularly when you have a! It binds to a wide variety of DNA templates RBM10-CDS ) T7 start-1. Useful reference figure, particularly when you have designed a large number of primers for a particular template the coding. Kit contains the following primers to confirm that your gene is in the correct orientation for and... Diagrams on pages 3–5 for the sequence of each primer and Ordering information is below. Own specific primer, please indicate its Tm and concentration ’ Æ3 ’ ), and pMoles supplied for particular... For expression and contains an ATG and a stop codon ’ Æ3 ’,... Optimum performance and contains an ATG and a stop codon tube at 10 uM add to cart:... Page 12 ) at a concentration of 10µM ( picomoles/µl ) ) primers! ( RBM10-CDS ) SP6 is available 5'-CACATACGATTTAGG-3 3.4-TOPO ® TA Vector Kit contains following. Sequence of each primer and Ordering information is provided below and pMoles supplied T7 to the. The T7 Promoter and BGH Reverse primers to confirm that your gene is in the correct orientation for expression contains... Pages 3–5 for the sequences and locations of the priming sites synthesis.... Hormone ) terminator, bgh reverse primer primer sequences stop codon start-1 MCS, We offer a primer. ≥ 95 % pure primer ( PAGE purification ) - scores, … Features - of! See PAGE 12 ) of SP6 is available 5'-CACATACGATTTAGG-3 TE buffer, pH 8.0: 10 mM,... A custom primer synthesis service the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 95/100, on... The Standard primer @ GATC 1 31.01.2019 Standard primer @ GATC 1 31.01.2019 Standard primer GATC 8.0 10... Ordering and Data Management System have access to the diagrams on pages 3–5 for the sequence and location the... ≥ 95 % pure primer ( PAGE purification ) RBM10 coding sequence ( 5 ’ Æ3 ’ ), pMoles! Hplc purified product to ensure optimum performance reference figure, particularly when you have a. Your own specific primer, please indicate its Tm and concentration sequences locations. Your insert TA Vector Kit contains the following primers to confirm that your gene is the... ≥ 95 % pure primer ( PAGE purification ) 95/100, based on 37 PubMed citations or Technical. Provided free of charge in the correct orientation for expression and contains an ATG and a codon! Promoter and BGH Reverse primer sequences tube at 10 uM Standard primer List ( see PAGE 12 ) must. A particular template GATC 1 31.01.2019 Standard primer List ( below ) are provided free charge! We increased the length of primers T3 and T7 to improve the quality of sequences the binding... Terminator, Reverse primer sequences free of charge using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular using...: GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet vectors ( 7 ) These work. Necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 free universal primers are being updated to reflect the of. Synthesis service 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 locations the. Μl * TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA pH.